Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659203

gRNA Name: pax3 gRNA1
Synonyms:
Genomic Target: pax3

PAM Sequence: TGG
Sequence: 5' TAACGCAGGGCCTGATGCCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' TGGCATCAGGCCCTGCGTTA 3' |||||||||||||||||||| 3' ACCGTAGTCCGGGACGCAAT 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10S:42750873..42750892 18/20 Antisense off-target kalrn.S
tropicalis 10.0 Chr5:124994374..124994393 20/20 Antisense target pax3
Chr7:59725992..59726011 16/20 unknown
Publications
First: Efficient genome editing of genes involved in neural crest development using the CRISPR/Cas9 system in Xenopus embryos., Cell Biosci 2016            
Most recent:
View All Papers