Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659207

gRNA Name: tfap2a gRNA1
Synonyms:
Genomic Target: tfap2a

PAM Sequence: TGG
Sequence: 5' GGGATACCGCACCAGCTCTC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20
genomic

gRNA
5' GAGAGCTGGTGCGGTATCCC 3' |||||||||||||||||||| 3' CTCTCGACCACGCCATAGGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr6:90358867..90358886 20/20 Sense target tfap2a
Chr8:28430129..28430148 17/20 unknown
Publications
First: Efficient genome editing of genes involved in neural crest development using the CRISPR/Cas9 system in Xenopus embryos., Cell Biosci 2016            
Most recent:
View All Papers