Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659211

gRNA Name: tyr gRNA8
Synonyms:
Genomic Target: tyr

Sequence: 5' GGAAAGGAACATGGTCCCTCTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' CCAGAGGGACCATGTTCCTTTCC 3' ||||||||||||||||||||||| 3' GGTCTCCCTGGTACAAGGAAAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:140622046..140622068 19/23 Antisense off-target stat6.L
chr9_10S:86684551..86684573 19/23 Sense off-target LOC108703132
chr9_10S:89726957..89726979 19/23 Antisense off-target lmtk2.S
Scaffold24:2975312..2975334 19/23 unknown
tropicalis 10.0 Chr2:167828624..167828646 23/23 Sense target tyr
Chr7:26196491..26196513 19/23 unknown
Chr8:39082420..39082442 19/23 unknown
Publications
First:
Most recent:
View All Papers