Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659212

gRNA Name: tyr gRNA9
Synonyms:
Genomic Target: tyr

Sequence: 5' CCATGTTTGCAGGGGCCAGTTCC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' GGAACTGGCCCCTGCAAACATGG 3' ||||||||||||||||||||||| 3' CCTTGACCGGGGACGTTTGTACC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:171564454..171564476 20/23 Sense off-target grm5-like.L
chr2S:92740898..92740920 19/23 Antisense off-target map4k4-like.S
chr3L:9690184..9690206 19/23 Antisense off-target LOC108710791 [provisional:fat2]
chr3S:93595069..93595091 19/23 Sense off-target avpr1a.S
chr9_10S:2641736..2641758 20/23 unknown
chr1S:56932755..56932777 19/23 unknown
chr6L:130492564..130492586 19/23 unknown
chr7L:68164855..68164877 19/23 unknown
tropicalis 10.0 Chr2:167828576..167828598 23/23 Sense target tyr
Chr3:102834551..102834573 19/23 unknown
Publications
First:
Most recent:
View All Papers