Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659301

gRNA Name: rab7a gRNA1
Synonyms: rab7 CRNP (S+L)
Genomic Target: rab7a

Sequence: 5' GGTGATGGTGGATGACAGATTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genomic

gRNA
5' CCAATCTGTCATCCACCATCACC 3' ||||||||||||||||||||||| 3' GGTTAGACAGTAGGTGGTAGTGG 5' 5' CCAATCTGTCATCCACCATCACC 3' ||||||||||||||||||||||| 3' GGTTAGACAGTAGGTGGTAGTGG 5' 5' CCAATCTGTCATCCACCATCACC 3' ||||||||||||||||||||||| 3' GGTTAGACAGTAGGTGGTAGTGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:130497167..130497189 23/23 Sense target rab7a.L
chr4S:108369915..108369937 23/23 Sense target rab7a.S
Scaffold24:112939..112961 20/23 Antisense off-target dnah12.L
chr4L:66718121..66718143 20/23 Antisense off-target LOC108713520 [provisional:npr1]
Scaffold23:514899..514921 19/23 Sense off-target lrmda.L
chr2L:109421670..109421692 19/23 Antisense off-target slc9a4.L
chr2S:69959506..69959528 19/23 Sense off-target grik3.S
chr4S:18432571..18432593 19/23 Antisense off-target pth.S
chr8L:57614487..57614509 19/23 Sense off-target LOC108698636 [provisional:capn2]
chr8S:87984530..87984552 19/23 Antisense off-target gphn.S
chr1S:19520032..19520054 20/23 unknown
chr9_10L:43125148..43125170 20/23 unknown
Scaffold52004:352..374 19/23 unknown
chr2L:145703372..145703394 19/23 unknown
chr3L:41064291..41064313 19/23 unknown
chr4S:10768036..10768058 19/23 unknown
chr5S:14969248..14969270 19/23 unknown
chr8L:77028390..77028412 19/23 unknown
tropicalis 10.0 Chr4:135620862..135620884 23/23 Sense target rab7a
Chr8:79813549..79813571 19/23 Sense off-target LOC100495980
Publications
First: Rab7 is required for mesoderm patterning and gastrulation in Xenopus., Biol Open 2021                                
Most recent:
View All Papers