Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659302

gRNA Name: rab7a gRNA2
Synonyms: rab7 CRNP (L)
Genomic Target: rab7a

Sequence: 5' GGGACACAGCTGGGCAGGAAAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 21/23 23/23 22/23
genomic

gRNA
5' CCTTTCTTGTCCAGCTGTGTCCC 3' |||||| || ||||||||||||| 3' GGAAAGGACGGGTCGACACAGGG 5' 5' CCTTTCCTGCCCAGCTGTGTCCC 3' ||||||||||||||||||||||| 3' GGAAAGGACGGGTCGACACAGGG 5' 5' CCTCTCCTGCCCAGCTGTGTCCC 3' ||| ||||||||||||||||||| 3' GGAAAGGACGGGTCGACACAGGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:130500319..130500341 23/23 Sense target rab7a.L
chr4S:108376259..108376281 22/23 Sense target rab7a.S
chr3S:52196326..52196348 22/23 Sense off-target rab27a.S
chr8S:31292864..31292886 22/23 Sense off-target rab14.S
chr3L:90698787..90698809 21/23 Sense off-target rab27a.L
chr3L:97833705..97833727 21/23 Sense off-target LOC108711436 [provisional:rasef]
chr3S:45576115..45576137 21/23 Sense off-target rasef.S
chr9_10L:107770175..107770197 21/23 Sense off-target LOC108701655 [provisional:rab26]
Scaffold33:1092247..1092269 20/23 Sense off-target rab3c.S
chr1L:152134935..152134957 20/23 Sense off-target rab36.L
chr1L:194216917..194216939 20/23 Sense off-target rab3c.L
chr1L:98508356..98508378 20/23 Sense off-target rab11b.1.L
chr1L:98550865..98550887 20/23 Sense off-target rab11b.2.L
chr1S:86809301..86809323 20/23 Sense off-target rab11b.1.S
chr1S:86875944..86875966 20/23 Sense off-target rab11b.2.S
chr2S:159510819..159510841 20/23 Antisense off-target arfip2.S
chr3S:61394912..61394934 20/23 Sense off-target rabl2b.S
chr8L:21276455..21276477 20/23 Sense off-target LOC108698313 [provisional:rab6b]
chr8S:27581349..27581371 20/23 Antisense off-target tesk1.S
chr8S:3769195..3769217 20/23 Sense off-target rab15.S
chr8S:50133197..50133219 20/23 Sense off-target LOC108700064 [provisional:rab6b]
chr1L:170895361..170895383 19/23 Antisense off-target snx24.L
chr1S:128406406..128406428 19/23 Antisense off-target zdhhc8.S
chr4L:90330284..90330306 19/23 Antisense off-target smg7.L
chr7L:121361707..121361729 19/23 Sense off-target htr6.L
chr1L:129410965..129410987 19/23 unknown
chr8L:42796238..42796260 19/23 unknown
tropicalis 10.0 Chr4:135624566..135624588 21/23 Sense target rab7a
Chr3:100765980..100766002 22/23 Sense off-target rab27a
Chr3:107550157..107550179 21/23 Sense off-target rasef
Chr3:5311707..5311729 21/23 Sense off-target rab19
Chr1:152442543..152442565 20/23 Sense off-target rab36
Chr3:89509913..89509935 20/23 Sense off-target rabl2b
Chr6:103954020..103954042 20/23 Sense off-target gnal
Chr8:37753399..37753421 20/23 Sense off-target rab33a
Chr3:116833481..116833503 19/23 Sense off-target rab11a
Chr9:6778962..6778984 19/23 Sense off-target prf1
Chr5:112439..112461 19/23 unknown
Chr6:23908527..23908549 19/23 unknown
Publications
First: Rab7 is required for mesoderm patterning and gastrulation in Xenopus., Biol Open 2021                                
Most recent:
View All Papers