Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659385

gRNA Name: icam5 gRNA1
Synonyms: trop icam5 T2
Genomic Target: icam5

Sequence: 5' CTCCTGACAACCGAACCATC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 19/20
genomic

gRNA
5' GATGGTTCGGTTGTCAGGAG 3' |||||||||||||||||||| 3' CTACCAAGCCAACAGTCCTC 5' 5' GATGGTACGGTTGTCAGGAG 3' |||||| ||||||||||||| 3' CTACCAAGCCAACAGTCCTC 5' 5' GATGGTACGGTTGTCAGGAG 3' |||||| ||||||||||||| 3' CTACCAAGCCAACAGTCCTC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:130726164..130726183 19/20 Sense target icam5.L
chr3S:119880328..119880347 19/20 Sense target icam5.S
chr3S:119882936..119882955 19/20 Sense target icam5.S
tropicalis 10.0 Chr3:137566253..137566272 20/20 Sense target icam5
Chr1:66719918..66719937 17/20 unknown
Publications
First:
Most recent:
View All Papers