Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659386

gRNA Name: il2rg gRNA1
Synonyms: laevis il2rg T1
Genomic Target: il2rg

Sequence: 5' CCTTCGCTGATCTTCATCACCCT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' AGGGTGATGAAGATCAGCGAAGG 3' ||||||||||||||||||||||| 3' TCCCACTACTTCTAGTCGCTTCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:22146430..22146452 23/23 Sense target il2rg.L
tropicalis 10.0 Chr1:175213696..175213718 19/23 unknown
Publications
First:
Most recent:
View All Papers