Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659390

gRNA Name: irx1 gRNA1
Synonyms: trop irx1 T1
Genomic Target: irx1

Sequence: 5' CCCGGTGTCCACCCAGCCACATT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' AATGTGGCTGGGTGGACACCGGG 3' ||||||||||||||||||||||| 3' TTACACCGACCCACCTGTGGCCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr6:68202714..68202736 23/23 Sense target irx1
Publications
First:
Most recent:
View All Papers