Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659393

gRNA Name: junb gRNA1
Synonyms: trop junb T2
Genomic Target: junb

PAM Sequence: CGG
Sequence: 5' GAAAGCTGGAGAGAATCGCCCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 22/23
genomic

gRNA
5' CCGGGCGATTCTCTCCAGCTTTC 3' ||||||||||||||||||||||| 3' GGCCCGCTAAGAGAGGTCGAAAG 5' 5' CCGGGCGATTCTCTCCAGCTTTC 3' ||||||||||||||||||||||| 3' GGCCCGCTAAGAGAGGTCGAAAG 5' 5' CCGGGAGATTCTCTCCAGCTTTC 3' ||||| ||||||||||||||||| 3' GGCCCGCTAAGAGAGGTCGAAAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:132962681..132962703 23/23 Sense target junb.L
Scaffold20:1768109..1768131 22/23 Sense target junb.S
chr7S:11253003..11253025 20/23 Sense off-target bub3.S
Scaffold87:357089..357111 19/23 Sense off-target setd1a.S
chr3L:38753368..38753390 19/23 Antisense off-target grk6.L
chr5S:109858561..109858583 19/23 Sense off-target dner.S
chr5S:111280531..111280553 19/23 Antisense off-target ephb1.S
chr9_10L:88873612..88873634 20/23 unknown
Scaffold861:2499..2521 19/23 unknown
chr1L:203015303..203015325 19/23 unknown
chr6L:106161930..106161952 19/23 unknown
chr8S:73543147..73543169 19/23 unknown
tropicalis 10.0 Chr3:140364889..140364911 23/23 Sense target junb
Chr3:118305470..118305492 19/23 Antisense off-target frmd5
Publications
First:
Most recent:
View All Papers