Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659396

gRNA Name: kng1 gRNA1
Synonyms: trop kng1 T2
Genomic Target: kng1

PAM Sequence: AGG
Sequence: 5' GTCAGCTATGATATACGAGAAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genomic

gRNA
5' CCTTCTCGTATATCATAGCTGAC 3' ||||||||||||||||||||||| 3' GGAAGAGCATATAGTATCGACTG 5' 5' CCTTCTCGTATATCATAGCTGAC 3' ||||||||||||||||||||||| 3' GGAAGAGCATATAGTATCGACTG 5' 5' CCTTCTCGTATATCATAGCTGAC 3' ||||||||||||||||||||||| 3' GGAAGAGCATATAGTATCGACTG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:102077708..102077730 23/23 Sense target kng1.L
chr5S:86912292..86912314 23/23 Sense target kng1.S
chr5S:15712060..15712082 20/23 Antisense off-target esrrg.S
chr7L:112990205..112990227 19/23 Sense off-target mgc147475.L
tropicalis 10.0 Chr5:105958635..105958657 23/23 Sense target kng1
Chr2:107786945..107786967 20/23 Antisense off-target dmd.3
Publications
First:
Most recent:
View All Papers