Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659406

gRNA Name: mcidas gRNA3
Synonyms: trop mcidas T2
Genomic Target: mcidas

Sequence: 5' CCTTGGGTCCTCAGGATTCCAGC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' GCTGGAATCCTGAGGACCCAAGG 3' ||||||||||||||||||||||| 3' CGACCTTAGGACTCCTGGGTTCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:24303829..24303851 21/23 Antisense off-target robo1.L
chr3S:58787986..58788008 21/23 Sense off-target lingo1.S
chr4L:107104250..107104272 19/23 Sense off-target rbfox2.L
chr7L:98986688..98986710 19/23 Antisense off-target LOC108696667 [provisional:sacs]
chr8L:98136060..98136082 19/23 Antisense off-target gphn.L
chr8S:67233626..67233648 20/23 unknown
tropicalis 10.0 Chr1:191671202..191671224 23/23 Sense target mcidas
Chr2:128125280..128125302 19/23 Sense off-target pcdh9
Chr5:120700503..120700525 19/23 unknown
Publications
First:
Most recent:
View All Papers