Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659407

gRNA Name: mitf gRNA1
Synonyms: laevis mitf T1
Genomic Target: mitf

PAM Sequence: AGG
Sequence: 5' GCGCTGCTTCCCGGTCCAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genomic

gRNA
5' CCTGGACCGGGAAGCAGCGC 3' |||||||||||||||||||| 3' GGACCTGGCCCTTCGTCGCG 5' 5' CCTGGACCGGGAAGCAGCGC 3' |||||||||||||||||||| 3' GGACCTGGCCCTTCGTCGCG 5' 5' CCTGGACCGGGAAGCAGCGC 3' |||||||||||||||||||| 3' GGACCTGGCCCTTCGTCGCG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:137394146..137394165 20/20 Antisense target mitf.L
chr4S:114711013..114711032 20/20 Antisense target mitf.S
Scaffold61:553660..553679 16/20 Antisense off-target cnnm2.L
tropicalis 10.0 Chr4:141536147..141536166 20/20 Antisense target mitf
Publications
First:
Most recent:
View All Papers