Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659408

gRNA Name: mitf gRNA2
Synonyms: trop mitf T1
Genomic Target: mitf

PAM Sequence: GGG
Sequence: 5' GCGCTGCTTCCCGGTCCAGGGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genomic

gRNA
5' CCCCCTGGACCGGGAAGCAGCGC 3' ||||||||||||||||||||||| 3' GGGGGACCTGGCCCTTCGTCGCG 5' 5' CCCCCTGGACCGGGAAGCAGCGC 3' ||||||||||||||||||||||| 3' GGGGGACCTGGCCCTTCGTCGCG 5' 5' CCCCCTGGACCGGGAAGCAGCGC 3' ||||||||||||||||||||||| 3' GGGGGACCTGGCCCTTCGTCGCG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:137394146..137394168 23/23 Antisense target mitf.L
chr4S:114711013..114711035 23/23 Antisense target mitf.S
chr3L:127695523..127695545 19/23 Sense off-target ddx39a.L
tropicalis 10.0 Chr4:141536147..141536169 23/23 Antisense target mitf
Publications
First:
Most recent:
View All Papers