Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659409

gRNA Name: msx1 gRNA1
Synonyms: trop msx1 T2
Genomic Target: msx1

PAM Sequence: TGG
Sequence: 5' GAACTCTGCCCTCTCGGCTATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genomic

gRNA
5' CCATAGCCGAGAGGGCAGAGTTC 3' ||||||||||||||||||||||| 3' GGTATCGGCTCTCCCGTCTCAAG 5' 5' CCATAGCAGAGAGGGCAGAGTTC 3' ||||||| ||||||||||||||| 3' GGTATCGGCTCTCCCGTCTCAAG 5' 5' CCATAGCAGAGAGGGCAGAGTTC 3' ||||||| ||||||||||||||| 3' GGTATCGGCTCTCCCGTCTCAAG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:18324720..18324742 22/23 Antisense target msx1.L
chr1S:16678344..16678366 22/23 Antisense target msx1.S
tropicalis 10.0 Chr1:25970229..25970251 23/23 Antisense target msx1
Publications
First:
Most recent:
View All Papers