Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659411

gRNA Name: myt1 gRNA1
Synonyms: trop myt1 T1
Genomic Target: myt1

PAM Sequence: AGG
Sequence: 5' CACAGCCAAAGTAGATACTGAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

gRNA
5' CCTCAGTATCTACTTTGGCTGTG 3' ||||||||||||||||||||||| 3' GGAGTCATAGATGAAACCGACAC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:78684561..78684583 20/23 Sense off-target LOC108711356 [provisional:epha5]
chr6L:43154289..43154311 19/23 Sense off-target LOC108718920 [provisional:kcnh8]
chr5L:77685846..77685868 20/23 unknown
chr7S:14217494..14217516 20/23 unknown
chr4L:95603062..95603084 19/23 unknown
chr8S:89397376..89397398 19/23 unknown
tropicalis 10.0 Chr10:1790867..1790889 23/23 Sense target myt1
Chr3:141506004..141506026 20/23 Antisense off-target LOC100497914
Chr5:149074331..149074353 19/23 Antisense off-target rhag
Chr6:129541484..129541506 20/23 unknown
Publications
First:
Most recent:
View All Papers