Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659472

gRNA Name: tbx2 gRNA1
Synonyms: trop tbx2 T6
Genomic Target: tbx2

PAM Sequence: AGG
Sequence: 5' GCCGTCCCTTCGGATGTATGAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 22/23 21/23 21/23
genomic

gRNA
5' CCTCATACATCCGAAGGGATGGC 3' ||||||||||||||||||| ||| 3' GGAGTATGTAGGCTTCCCTGCCG 5' 5' CTTCATACATCCGAAGGGATGGC 3' | ||||||||||||||||| ||| 3' GGAGTATGTAGGCTTCCCTGCCG 5' 5' CTTCATACATCCGAAGCGACGGC 3' | |||||||||||||| |||||| 3' GGAGTATGTAGGCTTCCCTGCCG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:90250792..90250814 21/23 Sense target tbx2.L
chr2S:75673405..75673427 21/23 Sense target tbx2.S
tropicalis 10.0 Chr2:92264390..92264412 22/23 Sense target tbx2
Publications
First:
Most recent:
View All Papers