Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659473

gRNA Name: tbx5 gRNA1
Synonyms: trop tbx5 T4
Genomic Target: tbx5

Sequence: 5' CCGTCACTTCATATCAGAACCAC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23 21/23
genomic

gRNA
5' GTGGTTCTGATATGAAGTGACGG 3' ||||||||||||||||||||||| 3' CACCAAGACTATACTTCACTGCC 5' 5' GTGGTTCTGATATGAGGTGACAG 3' ||||||||||||||| ||||| | 3' CACCAAGACTATACTTCACTGCC 5' 5' GTGGTTCTGATATGAGGTGACAG 3' ||||||||||||||| ||||| | 3' CACCAAGACTATACTTCACTGCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:144949904..144949926 21/23 Sense target tbx5.L
chr1S:119398665..119398687 21/23 Sense target tbx5.S
chr2L:68804244..68804266 19/23 Antisense off-target csmd1.L
chr9_10S:98410062..98410084 19/23 Sense off-target LOC108703224 [provisional:tex2]
tropicalis 10.0 Chr1:145962846..145962868 23/23 Sense target tbx5
Chr2:62878565..62878587 19/23 Antisense off-target LOC100495298
Publications
First:
Most recent:
View All Papers