Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659474

gRNA Name: tdrd1 gRNA1
Synonyms: trop tdrd1 T1
Genomic Target: tdrd1

Sequence: 5' CCGTCGCTCGACCCACCAGTTGT 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 20/23
genomic

gRNA
5' ACAACTGGTGGGTCGAGCGACGG 3' ||||||||||||||||||||||| 3' TGTTGACCACCCAGCTCGCTGCC 5' 5' ACAACTGGTGGGTCGAGCAATAG 3' |||||||||||||||||| | | 3' TGTTGACCACCCAGCTCGCTGCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr7L:2771550..2771572 20/23 Sense target tdrd1.L
tropicalis 10.0 Chr7:3932612..3932634 23/23 Sense target tdrd1
Publications
First:
Most recent:
View All Papers