Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659478

gRNA Name: tspan8 gRNA3
Synonyms: trop tspan8 T3
Genomic Target: tspan8

PAM Sequence: CGG
Sequence: 5' GTGGGGCCATAAGAGAAAGTCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

gRNA
5' CCGACTTTCTCTTATGGCCCCAC 3' ||||||||||||||||||||||| 3' GGCTGAAAGAGAATACCGGGGTG 5' 5' CCGACTTTCTCTAATGGCCCCGC 3' |||||||||||| |||||||| | 3' GGCTGAAAGAGAATACCGGGGTG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3L:51971087..51971109 21/23 Sense target tspan8.L
chr2L:176975211..176975233 19/23 Sense off-target LOC108707614 [provisional:dlg2]
chr5S:105478488..105478510 19/23 unknown
chr6S:101164787..101164809 19/23 unknown
tropicalis 10.0 Chr3:59630949..59630971 23/23 Sense target tspan8
Chr2:156931469..156931491 19/23 unknown
Chr4:49657733..49657755 19/23 unknown
Chr8:4905819..4905841 19/23 unknown
Publications
First:
Most recent:
View All Papers