Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23659616

Morpholino Name: foxm1 MO2
Synonyms: foxm1 MO e3i3
Target mRNA: foxm1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAAGGTACTGCACGTATAATGAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCTCATTATACGTGCAGTACCTTTC 3' ||||||||||||||||||||||||| 3' AGAGTAATATGCACGTCATGGAAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:65237201..65237225 21/25 unknown
tropicalis 10.0 Chr3:10382162..10382186 25/25 Sense target foxm1
Chr2:44806491..44806515 21/25 Antisense off-target ptchd1
Publications
First: Foxm1 regulates neural progenitor fate during spinal cord regeneration., EMBO Rep 2021                          
Most recent:
View All Papers