Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23659617

Morpholino Name: foxm1 MO3
Synonyms: foxm1 MO i3e4
Target mRNA: foxm1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCCCTTTATAGCCAAGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20
genomic

MO
5' TGCTTGGCTATAAAGGGAAA 3' |||||||||||||||||||| 3' ACGAACCGATATTTCCCTTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:105846270..105846289 18/20 Sense off-target strn3.L
Chr3S:77543100..77543119 17/20 Sense off-target grm8.S
Chr7L:3308301..3308320 17/20 Antisense off-target LOC108695699
Chr7S:2416386..2416405 17/20 Antisense off-target LOC108697311
Chr9_10L:94085044..94085063 17/20 Sense off-target hibch.L
Chr6S:19114886..19114905 16/20 Sense off-target kiaa1217.S
Chr7L:138753552..138753571 18/20 unknown
Chr6S:95102999..95103018 17/20 unknown
Chr8L:60145283..60145302 17/20 unknown
Chr6S:68434410..68434429 16/20 unknown
tropicalis 10.0 Chr3:10381379..10381398 20/20 Sense target foxm1
Chr2:172114792..172114811 18/20 Antisense off-target p2ry6
Chr2:98371842..98371861 17/20 Sense off-target caln1
Chr3:144198236..144198255 17/20 Sense off-target ap4m1
Chr9:84008043..84008062 17/20 Sense off-target zfand2b
Chr6:14568038..14568057 16/20 Sense off-target prkag2
Chr7:90616541..90616560 16/20 Antisense off-target morn1
Chr7:93546576..93546595 16/20 Antisense off-target LOC116412311
Chr5:130097225..130097244 17/20 unknown
Chr2:157510439..157510458 16/20 unknown
Publications
First: Foxm1 regulates neural progenitor fate during spinal cord regeneration., EMBO Rep 2021                          
Most recent:
View All Papers