Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659618

gRNA Name: foxm1 gRNA1
Synonyms: foxm1 CRISPR gRNA
Genomic Target: foxm1

Sequence: 5' CCTGAGCAAACCCTTGTCCATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

gRNA
5' CCATGGACAAGGGTTTGCTCAGG 3' ||||||||||||||||||||||| 3' GGTACCTGTTCCCAAACGAGTCC 5' 5' TCATGGGCAAGGGTTTGCTCAGG 3' ||||| |||||||||||||||| 3' GGTACCTGTTCCCAAACGAGTCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr3S:10268323..10268345 21/23 Sense target foxm1.S
chr5S:73289320..73289342 20/23 unknown
tropicalis 10.0 Chr3:10382604..10382626 23/23 Sense target foxm1
Chr6:143503533..143503555 20/23 Antisense off-target tg
Chr2:19264053..19264075 19/23 unknown
Publications
First: Foxm1 regulates neural progenitor fate during spinal cord regeneration., EMBO Rep 2021                          
Most recent:
View All Papers