Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659716

gRNA Name: tm4sf4 gRNA2
Synonyms: tm4sf4-T2
Genomic Target: tm4sf4

PAM Sequence: tgg
Sequence: 5' GGACTCATAGGAACAATCTG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 19/20 20/20
genomic

gRNA
5' CAGATTGTTCCTATGAGTCC 3' |||||||||||||||||||| 3' GTCTAACAAGGATACTCAGG 5' 5' CAGATTGTCCCTATGAGTCC 3' |||||||| ||||||||||| 3' GTCTAACAAGGATACTCAGG 5' 5' CAGATTGTTCCTATGAGTCC 3' |||||||||||||||||||| 3' GTCTAACAAGGATACTCAGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5S:103188361..103188380 20/20 Sense target tm4sf4.S
chr5L:120187637..120187656 19/20 Sense target tm4sf4.L
chr2L:161762233..161762252 17/20 Antisense off-target xpo4.L
chr3L:50153253..50153272 17/20 Sense off-target msrb3.L
Scaffold74:726470..726489 16/20 Sense off-target abhd6.L
chr7L:116531042..116531061 16/20 Sense off-target LOC108697058 [provisional:cmklr1]
chr4S:84442310..84442329 18/20 unknown
chr7S:40313576..40313595 18/20 unknown
chr6S:120004394..120004413 17/20 unknown
chr9_10S:67871494..67871513 17/20 unknown
tropicalis 10.0 Chr5:122346892..122346911 20/20 Sense target tm4sf4
Chr10:43870447..43870466 18/20 Sense off-target acsf2
Chr1:33816819..33816838 19/20 unknown
Chr5:110254542..110254561 18/20 unknown
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers