Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659717

gRNA Name: tyr gRNA12
Synonyms: tyrosinase
Genomic Target: tyr

PAM Sequence: tgg
Sequence: 5' GGCCCTCAGTTTCCATTCAC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20 18/20
genomic

gRNA
5' GAGAATGGAAACTGAGGGCC 3' | |||||||||||||||||| 3' CACTTACCTTTGACTCCCGG 5' 5' GAAAATGGAAACTGAGGGCC 3' | ||||||||||||||||| 3' CACTTACCTTTGACTCCCGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:149899586..149899605 18/20 Sense target tyr.S
chr7L:99871905..99871924 18/20 Antisense off-target ca11.L
chr1L:188434320..188434339 17/20 Sense off-target LOC108717944 [provisional:pde8b]
Scaffold450:12146..12165 18/20 unknown
chr6S:29199054..29199073 18/20 unknown
chr1S:133016058..133016077 17/20 unknown
chr7L:113270990..113271009 17/20 unknown
chr1S:101640823..101640842 16/20 unknown
tropicalis 10.0 Chr2:167828422..167828441 19/20 Sense target tyr
Chr5:122112988..122113007 17/20 Sense off-target cpa3
Publications
First: Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis., Development 2014                
Most recent:
View All Papers