Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659743

gRNA Name: tyr gRNA14
Synonyms: tyra-T
Genomic Target: tyr

PAM Sequence: TGG
Sequence: 5' GGGTCGATGATAGAGAGGAC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities
genomic

gRNA
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:171564278..171564297 20/20 Sense off-target grm5-like.L
chr9_10L:108006865..108006884 16/20 Antisense off-target pkd1.L
Publications
First: Targeted gene disruption in Xenopus laevis using CRISPR/Cas9., Cell Biosci 2015              
Most recent:
View All Papers