Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23659775

Morpholino Name: gpx3 MO1
Synonyms:
Target mRNA: gpx3

Morpholino Type: translation blocking morpholino
Sequence: 5' ATGGGGGTCAAATTTAGGGGGCTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 23/25
genomic

MO
5' ATAGCCCCCTAAGTTTGACCCCCAT 3' | |||||||||| |||||||||||| 3' TCTCGGGGGATTTAAACTGGGGGTA 5' 5' AGAGCCCCCTAAATTTGACCCCCAT 3' ||||||||||||||||||||||||| 3' TCTCGGGGGATTTAAACTGGGGGTA 5' 5' AGAGCCCCCTAAGTTTGAGCCCCAT 3' |||||||||||| ||||| |||||| 3' TCTCGGGGGATTTAAACTGGGGGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:27094605..27094629 25/25 Sense target gpx3.L
Chr3S:15147171..15147195 23/25 Sense target gpx3.S
Chr1S:24838249..24838273 21/25 Antisense off-target tbc1d1.S
Chr2L:9834542..9834566 21/25 Sense off-target tmprss2.8.L
Chr3S:110416106..110416130 21/25 Antisense off-target LOC108713277
Chr1S:160398739..160398763 21/25 unknown
tropicalis 10.0 Chr3:22012492..22012516 23/25 Sense target gpx3
Chr2:168973340..168973364 21/25 Antisense off-target usp35
Publications
First: Xenopus gpx3 Mediates Posterior Development by Regulating Cell Death during Embryogenesis., Antioxidants (Basel) 2020                
Most recent:
View All Papers