Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23659776

Morpholino Name: gpx3 MO2
Synonyms:
Target mRNA: gpx3

Morpholino Type: splice blocking morpholino
Sequence: 5' ACGCACATACCTGGCAGTCAAAAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GTTTTTGACTGCCAGGTATGTGCGT 3' ||||||||||||||||||||||||| 3' CAAAAACTGACGGTCCATACACGCA 5' 5' ATTTTTGATTGCCAGGTATGTGCGT 3' ||||||| |||||||||||||||| 3' CAAAAACTGACGGTCCATACACGCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:27104543..27104567 25/25 Antisense target gpx3.L
Chr3S:15137890..15137914 23/25 Antisense target gpx3.S
Chr5S:117670685..117670709 21/25 Antisense off-target ryk.S
Publications
First: Xenopus gpx3 Mediates Posterior Development by Regulating Cell Death during Embryogenesis., Antioxidants (Basel) 2020                
Most recent:
View All Papers