Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17262081

Xenopus ORFeome
What is the ORFeome?

ORF Name:MGC85087 ORF1 Species: laevis
Gene Symbol: sox3.L Entrez Gene ID: 398329
Gene Synonyms: sry, xlsox3, xsox3, xtsox3
Gene Name: SRY-box 3
Description: HMG-box transcription factor
Plate: GDExl11078 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836562
3' ORF Sequence: JZ836563
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC089283.1 Xenopus laevis cDNA clone MGC:84925 IMAGE:6322726, complete cds
Template Accession: BC089283
GI: 58399098
Clone ID: IMAGE:6322726
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATAGCATGTTGGACACAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGTGAGTGAGCGGTAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers