Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17268441

Xenopus ORFeome
What is the ORFeome?

ORF Name:cd151.L ORF1 Species: laevis
Gene Symbol: cd151.L Entrez Gene ID: 446702
Gene Synonyms:
Gene Name: CD151 molecule (Raph blood group)
Description: integral membrane protein
Plate: GDExl11053 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828615
3' ORF Sequence: JZ828616
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83668 protein, mRNA (cDNA clone MGC:83668 IMAGE:5085546), complete cds
Template Accession: BC077579
GI: 50415541
Clone ID: IMAGE:5085546
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGAGTTCAATGAGAAAAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATGGCTCCGACTTTAGGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers