Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269023

Xenopus ORFeome
What is the ORFeome?

ORF Name:ada2.L ORF1 Species: laevis
Gene Symbol: ada2.L Entrez Gene ID: 779128
Gene Synonyms: adgf, cecr1, cecr1-a, cecr1-b, idgfl
Gene Name: adenosine deaminase 2
Description:
Plate: GDExl11039 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827581
3' ORF Sequence: JZ827582
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis CECR1, mRNA (cDNA clone MGC:80775 IMAGE:5512816), complete cds
Template Accession: BC073357
GI: 49116835
Clone ID: IMAGE:5512816
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTGCGTCTCCCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCTCCTTCTTCCAGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers