Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271303

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctsv.L ORF1 Species: laevis
Gene Symbol: ctsv.L Entrez Gene ID: 447313
Gene Synonyms:
Gene Name: cathepsin V
Description: cysteine protease [KOG]
Plate: GDExl11049 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831504
3' ORF Sequence: JZ831505
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81823 protein, mRNA (cDNA clone MGC:81823 IMAGE:7008062), complete cds
Template Accession: BC080004
GI: 51258283
Clone ID: IMAGE:7008062
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTCTATCTAGTTGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCAGAGGATAACTGGCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers