Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17272995

Xenopus ORFeome
What is the ORFeome?

ORF Name:dpepe.L ORF1 Species: laevis
Gene Symbol: dpepe.L Entrez Gene ID: 378550
Gene Synonyms: aad-a, alpha-aspartyl dipeptidase, gene d, pepe
Gene Name: dipeptidase E
Description: protease
Plate: GDExl11061 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833214
3' ORF Sequence: JZ833215
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis alpha-aspartyl dipeptidase (gene D), mRNA (cDNA clone MGC:99107 IMAGE:7204770), complete cds
Template Accession: BC087353
GI: 56269513
Clone ID: IMAGE:7204770
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGACGATGAGGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTATGGCCTAAAAGAAAGCTAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers