Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279745

Xenopus ORFeome
What is the ORFeome?

ORF Name:hsp90ab1.S ORF1 Species: laevis
Gene Symbol: hsp90ab1.S Entrez Gene ID: 446459
Gene Synonyms: hsp90 beta, hsp90b, hsp90beta
Gene Name: heat shock protein 90kDa alpha family class B member 1
Description: Endoplasmic reticulum glucose-regulated protein (GRP94/endoplasmin), HSP90 family
Plate: GDExl11031 Well: A12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826281
3' ORF Sequence: JZ826282
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis heat shock 90kDa protein beta, mRNA (cDNA clone MGC:78910 IMAGE:4175543), complete cds
Template Accession: BC077195
GI: 50603917
Clone ID: IMAGE:4175543
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGAAGTTGCCCACAAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGACTTCCTCCATGCGAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers