Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17296737

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc22a7.L ORF1 Species: laevis
Gene Symbol: slc22a7.L Entrez Gene ID: 444396
Gene Synonyms: nlt, oat2
Gene Name: solute carrier family 22 (organic anion transporter), member 7
Description: Synaptic vesicle transporter SVOP and related transporters (major facilitator superfamily)
Plate: GDExl11044 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828229
3' ORF Sequence: JZ828228
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC82937 protein, mRNA (cDNA clone MGC:82937 IMAGE:5514338), complete cds
Template Accession: BC073620
GI: 49256170
Clone ID: IMAGE:5514338
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTTGAGGATGTCCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACCAGGTGGCGATACCGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers