Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304237

Xenopus ORFeome
What is the ORFeome?

ORF Name:vip.L ORF1 Species: laevis
Gene Symbol: vip.L Entrez Gene ID: 373781
Gene Synonyms: phm27, vasoactive intestinal peptide
Gene Name: vasoactive intestinal peptide
Description:
Plate: GDExl11012 Well: A03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823988
3' ORF Sequence: JZ829296
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis vasoactive intestinal peptide, mRNA (cDNA clone MGC:53042 IMAGE:5537417), complete cds
Template Accession: BC043792
GI: 27696275
Clone ID: IMAGE:5537417
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACACAGAAGCATCTTTCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTTCAATTGGAGGTGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers