Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19761107

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctsv ORF1 Species: tropicalis
Gene Symbol: ctsv Entrez Gene ID: 448179
Gene Synonyms:
Gene Name: cathepsin V
Description: cysteine protease [KOG]
Plate: GDExt11009 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133375.1
ORF Translation: ATO94727.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis MGC69486 protein, mRNA (cDNA clone MGC:69486 IMAGE:5336282), complete cds
Template Accession: BC074718
GI: 49522050
Clone ID: IMAGE:5336282
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTCTATCTAGGTATTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCAGAGGATAACTGGCA


Publications
First:
Most recent:
View All Papers