Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774461

Xenopus ORFeome
What is the ORFeome?

ORF Name:tmem17 ORF1 Species: tropicalis
Gene Symbol: tmem17l Entrez Gene ID: 548354
Gene Synonyms:
Gene Name: transmembrane protein 17 like
Description:
Plate: GDExt11024 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134768.1
ORF Translation: ATO96120.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical LOC548354, mRNA (cDNA clone MGC:108208 IMAGE:7016441), complete cds
Template Accession: BC089071
GI: 57870623
Clone ID: IMAGE:7016441
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCAGGCTGCGGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTCGGCCATCCAAGT


Publications
First:
Most recent:
View All Papers