|
XB-LINE-1424
Line Name: Xtr.myt1emHorb
|
|
Summary | |
---|---|
Synonym: | Xtr.myt1tmHorb |
Species: | Xenopus tropicalis |
Background Strain: | Xtr.Nigerian1NXR |
Paternal Line: | |
Maternal Line: | |
Description: | CRISPR knockout of myt1 (myelin transcription factor 1). Germ line transmission confirmed. Animals carry a 5 base pair insertion. Contact NXR for more details. |
Phenotype Description: | +5 base pair mutation sequence TTTTATTCTCTGTCTCCTCAGT(CTCTT)ATCTACTTTGGCTGTGCTTT. Associated with human Goldenhar syndrome. |
Color Morph: | pigmented |
Breeding Type: | OUTBRED |
Lab of Origin: | NXR |
Line Type: | Mutant |
Mutated Gene(s): | myt1 |
MTA Required: | No |
Public: | Yes |
Catalogue Number: | NXR_3036 |
Stock Center | RRID | Generation | Availability | Mutant Details | |
---|---|---|---|---|---|
NXR (US) | NXR_3036 | F1 | Order | ||
EXRC (Europe) | |||||
NBRP (Japan) | |||||
XLRRI (US) |
Back to Search Lines