Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-LINE-1424

Line Name: Xtr.myt1emHorb


Summary
Synonym: Xtr.myt1tmHorb
Species: Xenopus tropicalis
Background Strain: Xtr.Nigerian1NXR
Paternal Line:
Maternal Line:
Description: CRISPR knockout of myt1 (myelin transcription factor 1). Germ line transmission confirmed. Animals carry a 5 base pair insertion. Contact NXR for more details.
Phenotype Description: +5 base pair mutation sequence TTTTATTCTCTGTCTCCTCAGT(CTCTT)ATCTACTTTGGCTGTGCTTT. Associated with human Goldenhar syndrome.
Color Morph: pigmented
Breeding Type: OUTBRED
Lab of Origin: NXR
Line Type: Mutant
Mutated Gene(s): myt1
MTA Required: No
Public: Yes
Catalogue Number: NXR_3036

Stock Center RRID Generation Availability Mutant Details
NXR (US) NXR_3036 F1 Order
EXRC (Europe)
NBRP (Japan)
XLRRI (US)

Back to Search Lines