|
XB-CLONE-1518978
Clone Name: IMAGE:8738382 | Gene: ankrd11.L | Species: Xenopus laevis | |
Sequence:
5' EST: EE304595
[+]
Library:
Name: NICHD_XGC_panc | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
Anatomy: pancreas | Stage: frog |
Normalized: No | Subtraction: No |
Vector Details | Vector Map | Name: pCS111 Type: plasmid 5' Restriction Site: SmaI 3' Restriction Site: NotI | ![]() |
Usage:
Suppliers:
Search for clone at: Open Biosystems