|
XB-CLONE-1615963
Clone Name: IMAGE:8319968 | Gene: lgals4.2.L | Species: Xenopus laevis | |
Sequence:
5' EST: DY549642
[+]
Library:
Name: NICHD_XGC_Emb10 | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 1.8kb. This is a normalized library (primary library is NICHD_XGC_Emb9) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
Anatomy: whole organism | Stage: NF stage 17 to NF stage 19 |
Normalized: No | Subtraction: No |
Vector Details | Vector Map | Name: pExpress-1 Type: plasmid 5' Restriction Site: EcoRV 3' Restriction Site: NotI | ![]() |
Usage:
Suppliers:
Search for clone at: Open Biosystems