Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1651297

Clone Name: IMAGE:7974570 Gene: ythdf1.L Species: Xenopus laevis  
 

Sequence:

5' EST: DR722700 [+]

Library:

Name: NICHD_XGC_Emb9External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.1kb. This is a non-normalized primary library (normalized library is NICHD_XGC_Emb10) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: whole organismStage: NF stage 17 to NF stage 19
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image

Usage:


Suppliers:

Search for clone at: Open Biosystems