Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1807083

Clone Name: IMAGE:7208605 Gene: gla.S Species: Xenopus laevis  
 

Sequence:

Full length sequence: BC106337 [+]

5' EST: CK807750 [+]

3' EST: CN317955 [+]

Library:

Name: NICHD_XGC_Te2External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.25 kb. This is a primary library (normalized primary library is NICHD_XGC_Te2N) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: testisStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI
Expression Image

Usage:


Suppliers:

Search for clone at: Open Biosystems