|
XB-CLONE-2649845
| Clone Name: IMAGE:8958570 | Gene: tph1 | Species: Xenopus tropicalis | |
Sequence:
5' EST: EL663106 
[+]
Library:
| Name: NICHD_XGC_tropInt_63 | External Dbs: Unigene tropicalis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 2.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Anatomy: intestine | Stage: unspecified stage |
| Normalized: No | Subtraction: No |
| Vector Details | Vector Map | Name: pCS111 Type: plasmid 5' Restriction Site: SmaI 3' Restriction Site: NotI |  |
Usage:
Suppliers:
Search for clone at: Open Biosystems