Sumanas S and Ekker SC (2001), Xenopus frizzled-7 morphant displays defects in...

XB-ART-8645

Genesis 2001 Jul 01;303:119-22. doi: 10.1002/gene.1044.

Show Gene links Show Anatomy links

Xenopus frizzled-7 morphant displays defects in dorsoventral patterning and convergent extension movements during gastrulation.

Sumanas S , Ekker SC .

Abstract

PubMed ID: 11477687
Article link: Genesis

Species referenced: Xenopus laevis
Genes referenced: fzd7 nodal3.2 tbx2 wnt8a
Morpholinos: fzd7 MO3 fzd7 MO5

Article Images: [+] show captions

FIG. 1. Analysis of Xfz7 morphant phenotype. (a) Xfz7 morphants display blastopore closure defects. Adding synthetic Xfz7 RNA alleviates the phenotype. (a) Uninjected control embryo. (b) 5 ng MO-injected embryo. (c) 10 ng MO-injected embryo. (d) Embryo injected with 10 ng MO and 100 pg Xfz7 RNA. (e) Xfz7 morphants display defects in dorsoanterior structures. Addition of synthetic Xfz7 RNA alleviates the phenotype. (e) Uninjected control embryo. (f) 5 ng MO-injected embryo. (g) 10 ng MO-injected embryo. (h) Embryo injected with 10ng MO and 100pg Xfz7 RNA. (i) Distribution of embryos displaying different blastopore sizes. Blastopore enlargement was scored as weak, moderate or large/extreme. (j) Animal caps excised from Xfz7 morphants fail to elongate upon addition of activin. Xfz7 RNA alleviates the defect. (j) Caps from uninjected control embryos. (k) Caps from 10 ng MO-injected embryos. (l) Caps from embryos injected with 10 ng MO and 100 pg Xfz7 RNA. Notice that elongation is inhibited in (k), whereas (j) and (l) caps elongate well. (m) Northern blot of individual stage 10ï°‚ embryo samples. Note the reduced expression of the dorsal marker Xnr3, but not ventral marker Wnt8 in 10ng MO-injected embryos (MO lane) compared with controls (C lane). Expression is restored in embryos injected with 10 ng oligo and 100 pg Xfz7 RNA (MO ï°‚ R lane). Ethidium bromide staining was used as the loading control. For the quantitative evaluation of the expression, blots were exposed to PhosphorImager screen (Molecular Dynamics) and subsequently quantified by IPLabGel software and normalized to loading control. In all experiments shown, a combination of 5 ng of two Xfz7-specific morpholinos (2.5 ng each) or 10 ng (5 ng each) (synthesized by GeneTools, sequences are CCGGCTCCAACAAGTGATCTCTGG and GCGGAGTGAGCAGAAATCGGCTGAT) was injected into unfertilized Xenopus oocytes, subsequently colored with vital dyes, and fertilized using the host transfer method (Heasman et al., 1994). Each experiment was repeated at least twice and representative embryos are shown.