Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311122

Morpholino Name: cdx2 MO1
Synonyms: Cdx2/Xtcad1 MO
Target mRNA: cdx2

Morpholino Type: uncategorized morpholino
Sequence: 5' AACAAGTAACTCACGTACATGGCGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genome
MO
5' CCGCCATGTACGTGAGTTACTTGTT 3'
   |||||||||||||||||||||||||
3' GGCGGTACATGCACTCAATGAACAA 5'
5' CCACCATGTACGTGAGTTACTTGTT 3'
   || ||||||||||||||||||||||
3' GGCGGTACATGCACTCAATGAACAA 5'
5' CCACCATGTACGTGAGTTACTTATT 3'
   || ||||||||||||||||||| ||
3' GGCGGTACATGCACTCAATGAACAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:164616362..164616386 24/25 Antisense target cdx2.L
Chr2S:147248419..147248443 23/25 Antisense target cdx2.S
tropicalis 10.0 Chr2:155090209..155090233 25/25 Antisense target cdx2
Publications
First: Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis., Dev Dyn 2009                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers