Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17311123

Morpholino Name: cdx4 MO1
Synonyms: Cdx4/Xtcad3 MO
Target mRNA: cdx4

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCTTGGTGGTCATCTTTATCCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 22/25
genome
MO
5' GAGGATAAAGATGACCACCAAGGAT 3'
   |||||||||||||||||||||||||
3' CTCCTATTTCTACTGGTGGTTCCTA 5'
5' GAGAGCAAAGATGACCACCAAGGAT 3'
   |||   |||||||||||||||||||
3' CTCCTATTTCTACTGGTGGTTCCTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:37936060..37936084 22/25 Antisense target cdx4.L
Chr4S:123508768..123508792 21/25 Sense off-target magi1.S
Chr2S:164406102..164406126 21/25 unknown
tropicalis 10.0 Chr8:47048811..47048835 25/25 Antisense target cdx4
Publications
First: Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis., Dev Dyn 2009                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers