Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17328442

Morpholino Name: hbg1 cMO1
Synonyms: Hsa.beta-globin intron mutation, Mutant B-globin, control morpholino
Target mRNA: hbg1

Morpholino Type: control morpholino
Sequence: 5' CCTCTTACCTCAGTTACAATTTATA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:26450138..26450162 21/25 Antisense off-target ppp2r2c.L
Chr3L:89088556..89088580 21/25 unknown
Chr5S:126566922..126566946 21/25 unknown
tropicalis 10.0 Chr3:121113366..121113390 21/25 Sense off-target LOC100493925
Chr1:74282349..74282373 22/25 unknown
Publications
First: Developmental role of plk4 in Xenopus laevis and Danio rerio: implications for Seckel Syndrome., Biochem Cell Biol 2015    
Most recent: Microsyntenic Clusters Reveal Conservation of lncRNAs in Chordates Despite Absence of Sequence Conservation., Biology (Basel) 2019              
View All Papers