Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249106

Morpholino Name: abi1 MO1
Synonyms: Abi1 MO
Target mRNA: abi1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GCGCATCGCTTCCTCCTTGTACACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' AGTGTAAAAGGAGGAAGCGATGCGC 3'
   |||||| ||||||||||||||||||
3' TCACATGTTCCTCCTTCGCTACGCG 5'
5' AGTGTACAAGGAGGAAGCGATGCGC 3'
   |||||||||||||||||||||||||
3' TCACATGTTCCTCCTTCGCTACGCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:18487724..18487748 25/25 Antisense target abi1.S
Chr6L:24224611..24224635 23/25 Antisense off-target LOC108718781
Chr3S:120181396..120181420 21/25 Antisense off-target pcdha13.S
tropicalis 10.0 Chr6:24957867..24957891 24/25 Antisense target abi1
Chr3:71766086..71766110 21/25 Antisense off-target tubgcp6
Publications
First: Abelson interactor 1 (ABI1) and its interaction with Wiskott-Aldrich syndrome protein (wasp) are critical for proper eye formation in Xenopus embryos., J Biol Chem 2013  
Most recent:
View All Papers