Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249109

Morpholino Name: abl2 MO2
Synonyms: Arg-MO
Target mRNA: abl2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCCTACCTGCTGGCCCATCACCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/23 23/23 23/23
genome
MO
5' CGGGGATGGGCCAGCAGGTAGGC 3'
   ||| |||||||||||||||||||
3' GCCACTACCCGGTCGTCCATCCG 5'
5' CGGTGATGGGCCAGCAGGTAGGC 3'
   |||||||||||||||||||||||
3' GCCACTACCCGGTCGTCCATCCG 5'
5' CGGTGATGGGCCAGCAGGTAGGC 3'
   |||||||||||||||||||||||
3' GCCACTACCCGGTCGTCCATCCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:95511126..95511148 23/23 Antisense target abl2.L
Chr4S:79496852..79496874 23/23 Antisense target abl2.S
Chr9_10L:18226108..18226130 19/23 Antisense off-target sox18.L
Chr9_10L:18226108..18226130 19/23 Sense off-target LOC108701997
Chr9_10L:18226108..18226130 19/23 Sense off-target LOC108702054
Chr1L:3730707..3730729 19/23 unknown
Chr1L:6254494..6254516 19/23 unknown
Chr1S:108504029..108504051 19/23 unknown
Chr1S:137156228..137156250 19/23 unknown
Chr2L:177450965..177450987 19/23 unknown
tropicalis 10.0 Chr4:99890749..99890771 22/23 Antisense target abl2
Chr1:192658104..192658126 20/23 Sense off-target itga2
Chr2:64812235..64812257 19/23 Sense off-target cntn2
Chr5:13135213..13135235 19/23 Sense off-target ush2a
Chr5:19652658..19652680 19/23 Sense off-target prkce
Chr9:5190384..5190406 19/23 Sense off-target dppa2
Chr9:39126476..39126498 19/23 Sense off-target rbfox1
Chr9:5190384..5190406 19/23 Antisense off-target dusp14
Chr2:178381221..178381243 19/23 Antisense off-target LOC116408931
Chr9:85545862..85545884 19/23 Antisense off-target LOC116407773
Chr8:23229635..23229657 20/23 unknown
Chr2:151564039..151564061 19/23 unknown
Chr2:151564793..151564815 19/23 unknown
Chr4:45166244..45166266 19/23 unknown
Chr4:48815400..48815422 19/23 unknown
Chr5:160277218..160277240 19/23 unknown
Chr6:126915054..126915076 19/23 unknown
Chr6:77139667..77139689 19/23 unknown
Chr6:82536055..82536077 19/23 unknown
Chr7:85645129..85645151 19/23 unknown
Chr9:11132571..11132593 19/23 unknown
Chr9:11134150..11134172 19/23 unknown
Publications
First: The cytoplasmic tyrosine kinase Arg regulates gastrulation via control of actin organization., Dev Biol 2012                                          
Most recent:
View All Papers